Python Day 2 by Miaomiao Zhou

Chun + Mohammed

2017-02-08 10:01:52 UTC

print sum(range(101,200,2))

MM

miaomiaozhou88 — 2017-02-08 10:07:33 UTC

a = 100 # define input a

b = 200 # define input b

addup = 0 # define sum

while a
a=a+1 # a increases, remember, we are making a a variable

if a%2==1: # if a devided by 2 remains 1, it is an odd number

addup +=a # then the odd number add up each other, you can also do addup = addup+a

print addup # gives your final sum

#print addup #

Rosalind 3

2017-02-08 10:19:42 UTC

class DnaString(str):
def __new__(self, s):
return str.__new__(self, s.strip().upper())

def __init__(self, _):
self.num_A = self.count("A")
self.num_C = self.count("C")
self.num_G = self.count("G")
self.num_T = self.count("T")

def stats(self):
return len(self), self.num_A, self.num_C, self.num_G, self.num_T

dna = raw_input("Enter DNA sequence:")
d = DnaString(dna)

print(d)
print(d.stats())

MM

miaomiaozhou88 — 2017-02-08 10:20:23 UTC

#ask for the DNA string from a user input
DNA_string = raw_input("DNA?")
# define your counter, we count from 0, each nuclear has one counter
a = 0
t = 0
c = 0
g = 0

# now count what is in your DNA sequence
for i in DNA_string: #the for loop which look at each letter in the string
if i=="A":
a+=1
elif i=="T":
t+=1
elif i=="C":
c+=1
else:
g+=1
print "Count of A is %s, T is %s, C is %s, G is %s"%(a,t,c,g) # creat a string with the answer

Rosalind 3

2017-02-08 10:21:50 UTC

from __future__ import division

seq = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAG"

dna_count = seq.count("A") + seq.count("T") + seq.count("G") + seq.count("C")

print seq.count("A"),"is het aantal A's"

print seq.count("C"),"is het aantal C's"

print seq.count("G"),"is het aantal G's"

print seq.count("T"),"is het aantal T's"