<?xml version="1.0"?>
<rss version="2.0">
   <channel>
      <title>Family Hominidae by Kate Spurlock</title>
      <link>https://padlet.com/ks466/spog4d2hfn68</link>
      <description>Evidence of Evolution (Kate Spurlock)
</description>
      <language>en-us</language>
      <pubDate>2017-05-26 12:29:46 UTC</pubDate>
      <lastBuildDate>2024-07-22 21:43:21 UTC</lastBuildDate>
      <webMaster>hello@padlet.com</webMaster>
      <image>
         <url></url>
      </image>
      <item>
         <title>Great Apes: Major Characteristics</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/173976008</link>
         <description><![CDATA[<div>Great Apes share several characteristics:<br><strong>External</strong>:&nbsp; Males are larger than females, Pollex (thumbs) and hallux (big toes) are opposable (expect humans do not have opposable toes), flat nails, no tail, nostrils are close together, faces face downward. <br><strong>Internal</strong>: Vestigial appendix, large teeth for chewing, large skulls that allow for large brain cases. <br><strong>Behavioral</strong>: Most great apes are frugivorous and folivorous eaters (eating mainly fruits and leaves). They are good climbers and make nests in trees or on the ground for shelter. The nests are made of branches and leaves. They get around by using quadrupedal knuckle walking or bipedalism.&nbsp;</div><div>They have very complex social behaviors compared to other animals in the animal kingdom. This is shown through their facial expressions, verbal communications, and ability to construct simple tools for various activities.&nbsp;</div><div>Great apes give birth to one offspring at a time and must wait several years between each birth. Mothers stay with their young for an extended period of time and raise them until they mature. Social bonds are primarily between mother and child. <br><strong>Habitat</strong>: Most great ape populations are concentrated in Africa and some are in Asia. Humans are found all over the globe.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-26 12:30:59 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/173976008</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/173976306</link>
         <description><![CDATA[]]></description>
         <enclosure url="http://d2ouvy59p0dg6k.cloudfront.net/img/great_apes_1x4_352608.jpg" />
         <pubDate>2017-05-26 12:33:21 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/173976306</guid>
      </item>
      <item>
         <title>               Three Exemplary Organisms</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/173976475</link>
         <description><![CDATA[]]></description>
         <enclosure url="" />
         <pubDate>2017-05-26 12:34:47 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/173976475</guid>
      </item>
      <item>
         <title>Common Chimpanzee</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/173976607</link>
         <description><![CDATA[<div><em>Pan Troglodytes</em></div><div><strong>Location and Habitat</strong>:<br>Chimpanzees live in many habitats including dry savannas, evergreen rain forests, mountainous ares, and swamp forests. Their many habitats allows chimps to adapt rather quickly. Most species live in the equatorial region of Africa. <br><strong>Physical Characteristics</strong>:<br>Subspecies of chimpanzees do not live very far apart, as a result, morphology between subspecies of is not significantly different. Common chimps have a robust build; men weigh 88.2-132 lbs and women weigh 70.5-104 lbs. On average all chimps are about 2.68 ft tall. They have black or brown hair with hairless ears, fingers, feet soles, and faces, white beards (male and female), and white ends on their bottoms.<br><strong>Behavioral characteristics</strong>:<br>Chimps either walk on knuckles or on two legs. Half their time is spent in trees and the other time they are on the ground as they may establish sleeping nests in either location. A large portion of their day consists of eating and moving around to find more food sources. Chimps have mental maps in order to hunt for food efficiently, which proves their advanced intelligence compared to other species in the animal kingdom.  Lifespan is about 40-45 years old. Gestation is about 8 months; offspring stay close to their mothers for 6-9 years. Diet includes fruit, leaves, seeds, bark, insects, birds, honey, soil, bird’s eggs. </div><div><br></div>]]></description>
         <enclosure url="http://www.chimpworlds.com/wp-content/uploads/common_chimp_624.jpg" />
         <pubDate>2017-05-26 12:35:55 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/173976607</guid>
      </item>
      <item>
         <title>Western Lowland Gorilla</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/173976767</link>
         <description><![CDATA[<div><em>Gorilla Gorilla</em></div><div><strong>Location and Habitat: <br></strong>They can be found within a 273,746 square mile range throughouteast central and equatorial west Africa including Nigeria, Cameroon, Central African Republic (CAR), Equatorial Guinea, Gabon, Republic of Congo, Angola, and far-western Democratic Republic of Congo (DRC). <br>Their habitat consists of lowlands and swamps. The most elevated they can live is 5249 ft above sea level. In mixed swamp habitats, there is a dry season (December-March)&nbsp; and a rainy season (August-November) About 5 ft of rain a year.&nbsp; <br><strong>Physical characteristics:<br></strong>Dark brown or black hair with black skin; western gorillas have brown hair on head. Most adult males grow silver fur extending from their shoulders to their back side to show superiority. Men have a more visible and exaggerated sagittal crest; a point at the top of the head where the skull bones meet. Male and female have different external characteristics; men weigh up to 400 lbs in nature, but in captivity, they can weigh 500 lbs. Height is about 5.5 ft. Females weigh between 159 and 216 lbs. Height about 4.9 ft. <br><strong>Behavioral characteristics:<br></strong>They are quadrupedal knuckle walkers,&nbsp; but sometimes upright. Sometimes climbs trees; adults must climb trees with thick trunks in order to sustain their weight. They alternate between rest periods, travel periods, and feeding periods; it is a continuous cycle. Their habitat lacks terrestrial herbs, but there is an abundance of aquatic herbs and herbaceous vegetation. Fruit is a major component of their diet, as a result their feeding courses range the largest out of any gorilla (From about 2.7-5.41 miles). Each day, western gorilla travel about .68 of a mile. Termites and ants are key as well.<br>They travel in groups less than 20. They do not live in bachelor groups (always a breeding female). And if a silver back dies in a group, each female migrates to a new group to seek protection from males. Groups include one silver back, several females, and their offspring.&nbsp;<br>Females carry offspring for 8.5 months. Mothers must take care of the children for many years during development, the fathers are important because they help develop social traits.&nbsp;<br>After about 6 years, the offspring does not have to constantly be attached to their mothers, but it takes three years without breast feeding before the female can reproduce again. The average lifespan is about 30-40 years old in the wild and up to 50 years in captivity.<br>Gorillas communicate with a series of grunt sounds that all signify different meanings; most communication occurs during feeding times. This is demonstrating high levels of intelligence.&nbsp;</div>]]></description>
         <enclosure url="http://www.enjoyequatorialguinea.com/wp-content/uploads/2015/11/Western-Lowland-Gorilla-920x540.jpg" />
         <pubDate>2017-05-26 12:37:15 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/173976767</guid>
      </item>
      <item>
         <title>Bornean Orangutan</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/173978071</link>
         <description><![CDATA[<div><em>Pongo Pygmaeus</em></div><div><strong>Location and Habitat: </strong><br>Bornean orangutans live in isolated fragments of the oldest forests on Earth and are concentrated in the Southeast Asian Island of Borneo. The orangutans live in hilly, mountainous areas and locations with lowland swamps.They often travel to&nbsp; grasslands, cultivated fields, gardens, young secondary forest, and shallow lakes. Swampy areas and lowlands provide a vast supply of fruit and insects.<br><strong>Physical characteristics:</strong><br>They have thin, rough orange, brown, or maroon hair. At birth, faces are pink, but they darken to black as they grow up. Most males develop droopy throat pouches and exaggerated cheek pads, which are covered in short hairs. Flanged males are socially considered adults. Females prefer to mate with the flanged males.&nbsp;<br>Their fingers and toes are curved to help grab things easily. Males weigh about 192 lbs and are about 3.18 ft tall. Females weigh on average 81.6 lbs and are 2.56 ft tall.&nbsp;</div><div><strong>Behavioral characteristics:<br></strong>Their time is spent either on the ground or in trees. They move horizontally through trees with both their hands and feet, using their opposable thumbs and big toes to help them move quickly. When they are on the ground, they walk on their fists, and sometimes walk on two feet.&nbsp;</div><div>They eat mostly fruit and insects including buds, open flowers, young leaves, bark, sap, vines, orchids, reed roots, bird eggs, spider webs, termites, caterpillars, ants, fungi, and honey. They often times consume more calories than necessary, and therefore, struggle with obesity. They spend their days eating, resting, and traveling to find more food. Males eat more and spend more time eating each day than females. They have two peak eating times, one in the morning, and the other in the late afternoon. On average they travel about .491 miles a day in search for new sleeping and eating areas and prepare their nests in ther new location at night.&nbsp;<br>Females carry offspring for 8.6 months. Fathers have no relationship with offspring so mothers and older siblings help develop young orangutan. Adolescence ranges between age 5 and 8. Once offspring reach that stage, they can start to search for another group to live in. Due to adolescence age, there may be up to eight years between births; there is a very limited time for reproduction and a lot of mating competition. Lifespan is up to 50 to 60 years in the wild.&nbsp;</div><div>Orangutans are very intelligent. They use materials to make useful tools and communicate with one another. However, they are semi-solitary so communication is not as important to them compared to other great apes.&nbsp;</div>]]></description>
         <enclosure url="http://animalsadda.com/wp-content/uploads/2015/05/Bornean-Orangutan.jpg" />
         <pubDate>2017-05-26 12:47:18 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/173978071</guid>
      </item>
      <item>
         <title>                      Evidence of Evolution </title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174147389</link>
         <description><![CDATA[]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 17:24:12 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174147389</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174147497</link>
         <description><![CDATA[<div><strong>F</strong><br><strong>O<br>S<br>S<br>I<br>L<br>S</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 17:26:14 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174147497</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174148223</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/2b6f123aacb3dc2f82fec35bde176e4e/Fossil_1b.png" />
         <pubDate>2017-05-28 17:38:06 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174148223</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174148270</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/9ed0127c5b756a5b86cd2cde5bfa8ea6/Fossil_1c.png" />
         <pubDate>2017-05-28 17:38:37 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174148270</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174152426</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/0fd3965050855bbe96ba61d6b3ea1259/Fossil_1a.png" />
         <pubDate>2017-05-28 18:54:36 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174152426</guid>
      </item>
      <item>
         <title>Chororapithecus abyssinicus </title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174152527</link>
         <description><![CDATA[<div>Lived about 10 million years ago in the Miocene Epoch<br><br>&nbsp;Chororapithecus abyssinicus fossilized teeth were thought to be from the first species of gorilla. The 8 molars and the 1 canine tooth are very similar to modern gorillas. The fossils show that they mainly ate high fiber plants. They also indicate that gorillas must have split from human’s and chimp’s common ancestor at least 10 million years ago.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 18:56:00 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174152527</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174153066</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/cc7fd252e24a8ce3df98c66c5a38ec66/Fossil_2a.png" />
         <pubDate>2017-05-28 19:04:46 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174153066</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174153114</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/149ad9dae18fd69c6477f72a2b073ac5/Fossil_2b.png" />
         <pubDate>2017-05-28 19:05:43 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174153114</guid>
      </item>
      <item>
         <title>Hispanopithecus laietanus skeleton</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174153183</link>
         <description><![CDATA[<div>Lived 10 million years ago in the Miocene Epoch<br><br>The elbow area, shoulder girdle, rib cage, and forelimb of a partial <em>Hispanopithecus laietanus </em>skeleton shows that the extinct ape used to swing through branches by their arms, and also walking on branches on all four limbs. This demonstrates to scientists that this species may be one of the common ancestors for all the great apes because they move around in similar ways. &nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 19:06:34 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174153183</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174154461</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/1fcb1f27b964d58ad767be1b1d9b5ea1/Fossil_3.png" />
         <pubDate>2017-05-28 19:26:09 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174154461</guid>
      </item>
      <item>
         <title>Gigantopithecus blacki molars</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174154525</link>
         <description><![CDATA[<div>Lived in the Minocene Epoche 23.03 to 5.3 million years ago<br><br></div><div>Gigantopithecus blacki are thought to be the last common ancestors of early hominins, who had thick enamel indicating they ate plants. Gigantopithecus blacki may be an extinct branch derived from early hominins during the very beginning of its evolution.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 19:27:13 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174154525</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174154917</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/b26b924323d095d4c8c3b1594db6dd03/Fossil_4.png" />
         <pubDate>2017-05-28 19:34:14 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174154917</guid>
      </item>
      <item>
         <title>Lucy</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174155157</link>
         <description><![CDATA[<div>Lived 3.2 million years ago in the Pliocene Epoch<br><br></div><div>Lucy shows evidence of evolution because she seems to be a transition from great apes to the first hominins. Her appearance and brain size were ape-like, but she walked on two feet like hominins. Lucy and other Australopithecus afarensis closed the gap between chimpanzees and human divergence. Her teeth had traces of grass and meat, meaning great apes were starting to transition from primarily tree habitats, to the ground. Lucy had stone markings on her fossils, which showed the developing brain capacity of great apes because these markings were possibly made with stone tools in order to eat meat. Other fossils and turtle eggs were found near her fossils. Fossil evidence shows that she was a part of a social group, just like chimps. Her fossils are smaller than those of males, indicating that men were larger and of greater power than females. She might have lived in a social group dominated by one male. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 19:38:05 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174155157</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174155392</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://fossilhistory.files.wordpress.com/2015/04/lucy-skeleton-from-apjpg-b80d96fff9e9a9e0.jpg" />
         <pubDate>2017-05-28 19:40:59 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174155392</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174156124</link>
         <description><![CDATA[<div><strong>B<br>I<br>O<br>C<br>H<br>E<br>M<br>I<br>S<br>T<br>R<br>Y</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 19:51:55 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174156124</guid>
      </item>
      <item>
         <title>DNA Anaylysis</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174156640</link>
         <description><![CDATA[<div>Currently, Washington University in Saint Louis is in the process of sequencing many genomes within all the great apes. By identifying all the nitrogen bases in their DNA, the similarities and differences between the great ape species can be determined. Researchers are using this data to determine the most prominent DNA differences in humans compared to the other great apes. Researches say, “Natural selection, population growth and collapse, geographic isolation and migration, climate and geological changes, and other factors shaped primate evolution.” They concluded that almost all of the chimpanzee genome is the same as the human genome as most of their nitrogen bases are the same.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 20:00:45 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174156640</guid>
      </item>
      <item>
         <title>Chromosomal Analysis</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174156837</link>
         <description><![CDATA[<div>All great apes, except humans have 48 chromosomes (24 pairs), humans only have 46 chromosomes (23 pairs). <br><br></div><div>Scientists have debated on how and why humans have one long #2 chromosomes but they other great apes have two short #2 chromosomes. The two hypotheses are either, the common ancestor to great apes had only one long chromosome, and when all the other apes, except humans split, they split to form two separate ones. The other, more commonly accepted hypothesis is that great ape's common ancestor had two short chromosomes for chromosome 2, 2a and 2b. Through speciation of humans, their second chromosome fused into one long chromosome.    </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 20:04:06 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174156837</guid>
      </item>
      <item>
         <title>Protein Analysis</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174156899</link>
         <description><![CDATA[<div>Comparative serology between chimpanzees and humans indicates that they have a shared history because their immune systems quickly recognize each other’s proteins. This happens because the antibodies in humans recognize the chimpanzee proteins, so they quickly attack it to protect itself to the foreign protein. Chimpanzee antibodies woud react just as quickly to the human protein because they have been exposed to it in their evolutionary past. The way in which the immune system reacts to proteins of another species can prove if those species share an evolutionary past.</div><div><br></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 20:05:23 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174156899</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174157326</link>
         <description><![CDATA[<div><strong>E<br>M<br>B<br>R<br>Y<br>O<br>L<br>O<br>G<br>Y</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 20:13:17 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174157326</guid>
      </item>
      <item>
         <title>Gestation and Development</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174165137</link>
         <description><![CDATA[<div>Gorillas are pregnant for 8.5 months, chimps are for 8 months and orangutans for 8.6 months. Humans are very close at a gestation period of 9 months. This shows that the embryos must develop similarly because they mature within a similar time period. They give birth to one child at a time, and there is a large period of time in between each child. Their bodies must recover from each pregnancy. However, great apes do not have a second child until their first can survive on their own; this is why great apes rarely go through menopause and if they do, it is during really old age. Great apes go through stages of development much slower than most other species, but not as slow as humans; this is why they are not pregnant as long as humans.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 22:37:27 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174165137</guid>
      </item>
      <item>
         <title>             Chimp</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174167732</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/6077fa1830b0c06110789339f1996fd5/Screen_Shot_2017_05_13_at_8_53_46_AM.png" />
         <pubDate>2017-05-28 23:34:33 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174167732</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174167765</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/5815d8c02aa65dec5e3360ad0a23035f/Screen_Shot_2017_05_13_at_8_52_15_AM.png" />
         <pubDate>2017-05-28 23:35:10 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174167765</guid>
      </item>
      <item>
         <title>                 Human</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174168363</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/5bd4059c37c2fbd2d77671d0910b1f73/human_embryo.jpg" />
         <pubDate>2017-05-28 23:45:19 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174168363</guid>
      </item>
      <item>
         <title>       Gorilla </title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174168511</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/33e89aa8929b8837a555414e25e0aaf6/Screen_Shot_2017_05_28_at_7_46_38_PM.png" />
         <pubDate>2017-05-28 23:47:15 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174168511</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174168715</link>
         <description><![CDATA[<div><strong>AN<br>A<br>T<br>O<br>M<br>Y<br><br>&amp;<br><br>P<br>H<br>Y<br>S<br>I<br>O<br>L<br>O<br>G<br>Y</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-28 23:49:41 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174168715</guid>
      </item>
      <item>
         <title>Skulls</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174302920</link>
         <description><![CDATA[<div>The skulls of great apes are very similar to those of humans, the structures are arranged in different ways. They consist of equivalent bones of the same names but, of course, different shapes and proportions. Gorillas do not have a forehead, large and distinctive brow ridge (supraorbital torus), small braincase (for smaller brain than in humans), face projects forwards, prominent canine teeth, and large zygomatic arch (check bones) for chewing actions. Humans have high foreheads, small brow ridges, larger braincase (to enclose larger human brain), mouth sits behind rather than forward of the tip of the nose but chin projects forward of mouth, teeth include small molars, smaller zygomatic arch than in gorillas, and shallow lower jaw.</div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/2038f7afac31b4a888a8b4f313ac8053/Skull.png" />
         <pubDate>2017-05-29 21:36:24 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174302920</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174303055</link>
         <description><![CDATA[<div> All great apes develop human-like skulls a feti, but over time gorillas, chimpanzees, and orangutans specialized the shape of their skull and it loses its flat shape and starts to tilt and form a snout. This evolutionary change in humans allows them to walk upright and see forward. Other great apes walk on all fours and the tilt of the head allows them to see forward.</div><div><br></div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/c0c28c598e45e2c5240b65dfcfb610e6/Screen_Shot_2017_05_13_at_8_55_15_AM.png" />
         <pubDate>2017-05-29 21:37:49 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174303055</guid>
      </item>
      <item>
         <title>Brachiation</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174305980</link>
         <description><![CDATA[<div>Great apes all have brachiation, which allows them to swing with their arms. However,  humans and other ape have evolved into muscular organisms with heavy legs due to bipedalism. Today, most great apes are too heavy to utilize this function, but it is still apart of their anatomical structure. Within most of the species, mostly young apes are light enough to use their brachiation, and as they grow older, this function becomes more difficult to utilize. </div>]]></description>
         <enclosure url="https://www.youtube.com/watch?v=I2i2hUsJ794&amp;feature=youtu.be" />
         <pubDate>2017-05-29 22:25:12 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174305980</guid>
      </item>
      <item>
         <title>Homologous Structure</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174307034</link>
         <description><![CDATA[]]></description>
         <enclosure url="" />
         <pubDate>2017-05-29 22:42:59 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174307034</guid>
      </item>
      <item>
         <title>Opposable Thumbs</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174307060</link>
         <description><![CDATA[<div>A homologous structure shared by great apes is their opposable thumbs. This means that their thumbs can move independently from the other four fingers. With this ability, great apes can grasp objects. Opposable thumbs, to some degree, have influenced the mental capabilities of great apes. By being able to utilize a thumb in such a unique manner, primates are able to manipulate objects and develop tools that help them conduct daily activities quickly and easily. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-29 22:43:22 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174307060</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174307264</link>
         <description><![CDATA[<div>Lucy shares several traits with chimpanzees and several traits with humans. She may be the missing link in the chimpanzee/human split. </div>]]></description>
         <enclosure url="https://www.youtube.com/watch?v=xT8Np0gI1dI" />
         <pubDate>2017-05-29 22:46:49 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174307264</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174308768</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://qph.ec.quoracdn.net/main-qimg-e94c51777fa48053ec2aaf52517979b7" />
         <pubDate>2017-05-29 23:14:18 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174308768</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174309449</link>
         <description><![CDATA[<div><strong>D<br>N<br>A</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-29 23:24:53 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174309449</guid>
      </item>
      <item>
         <title>DNA Sequences</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174309509</link>
         <description><![CDATA[<div>Human: CAATAGATTCATTTCACTGAGGGAGGCAAAGGGCTGGTCAATAGA<br>Chimpanzee: CAA<strong>C</strong>AGATTCATTTCACTGAG<strong>A</strong>GA<strong>A</strong>GCAAAGGGCTGGGCAATAGA<br>Gorilla: CAATAGATTCATTTCACT<strong>A</strong>AG<strong>A</strong>GAGGCAAAGGGCTGGTCAAT<strong>G</strong>GA<br>Orangutan: CAATAGATTCATTTCACTG<strong>G</strong>G<strong>AA</strong>AGGCAAAG<strong>C</strong>GCT<strong>T</strong>GTCAA<strong>C</strong>AGA<br><br><br>Molecular biology can show evolutionary relationships by comparing DNA sequences of different species. If these molecular structures have similar genetic sequences, than their evolutionary pasts are related. These DNA sequences show that all great apes are very closely related, with few nitrogenous base differences. However, it shows that humans and chimpanzees and most related, and then gorillas and humans share the next closest relationship, and finally orangutans and humans.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-29 23:25:42 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174309509</guid>
      </item>
      <item>
         <title>Taxonomy</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174311709</link>
         <description><![CDATA[<div><br>Taxonomic classification demonstrates the evolutionary relationship between organisms. Each subgroup of taxonomy represents different amounts of kinship between organisms and the more taxonomic classification organisms share, the more closely related they are. These great apes are all closely related as they share most taxonomic classifications except genus and species.&nbsp;</div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/ae18e145dd609866e4b2387099ac6865/Screen_Shot_2017_05_29_at_7_48_50_PM.png" />
         <pubDate>2017-05-29 23:49:51 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174311709</guid>
      </item>
      <item>
         <title>Proconsul Africanus</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174391479</link>
         <description><![CDATA[<div>Lived about 14-23 million years ago in the Miocene Epoch<br><br>Proconsul africanus is an extent great ape who had a larger skulls than the average monkey, but smaller ones than apes and gorillas; it may prove to be a link between great apes and monkeys. The fossils found have also shows scientists that females of this species were smaller than males, just like the typical family hominidae species. The skull has all of its teeth and shows that they consumed fruit. Other fossils were uncovered that proved to be Proconsul africanus all in which show similarities between great apes and monkeys. Ape-like: shoulder and elbow, tapered bodies like chimpanzees, no tail. Monkey-like: wrist-&gt; tree dweller.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-30 12:08:07 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174391479</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174393704</link>
         <description><![CDATA[<div>Great apes do not have great differences in the amount of time for gestation. This proves that their embryos share similar development stages. The images show that humans, gorillas, and chimpanzees start growing from similar looking embryos. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-30 12:22:29 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174393704</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174394332</link>
         <description><![CDATA[<div>Differences between the duration of great ape development begin as embryos. Some hominidae species take longer than others to go through each stage of development. For example, humans are pregnant the longest and are considered adolescence for more years than chimpanzees are adolescence. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-30 12:26:19 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174394332</guid>
      </item>
      <item>
         <title>                                                           Family Hominidae</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174396205</link>
         <description><![CDATA[]]></description>
         <enclosure url="" />
         <pubDate>2017-05-30 12:34:45 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174396205</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174397781</link>
         <description><![CDATA[<div><strong>CHROMOSOMAL <br><br>ANA<br>L<br>Y<br>S<br>I<br>S</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-30 12:42:37 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174397781</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174592141</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/1e746afb45dee3621431ce2d6cbb3a39/Karyotype.png" />
         <pubDate>2017-05-31 10:45:06 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174592141</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174592810</link>
         <description><![CDATA[<div>The great ape chromosome has experienced many inversion mutations that have lead to one less chromosome in humans. However, these mutations that disrupted the human karyotype also affected other ape species as well, the mutations just are not as prominent. For example, a mutation occurred between orangutans and gorillas, and now orangutans have the most different second chromosome compared to gorillas, chimps, and humans.&nbsp;</div>]]></description>
         <enclosure url="https://www.youtube.com/watch?v=3sKScsbhOd4" />
         <pubDate>2017-05-31 10:49:59 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174592810</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174593713</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/c4b2fac4df39a4393dd61ac83630d27e/chromosome_2.png" />
         <pubDate>2017-05-31 10:58:26 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174593713</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174593768</link>
         <description><![CDATA[<div>To take a closer look, these are the number 2 chromosomes from left to right: human, chimpanzee, gorilla, orangutan. Clearly, humans are the only species that has one fused  number 2 chromosome. Despite the differences in chromosome count, great apes have very similar banding patterns. By reading form left to right, humans share more banding patterns with chimps, then gorillas, followed by orangutans. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 10:59:04 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174593768</guid>
      </item>
      <item>
         <title>Chromosomal Comparison between Gorillas and Chimpanzees</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174594478</link>
         <description><![CDATA[<div>Chimpanzees and Gorillas share many similarities between chromosomes 3,4,5, and 6. Now this is only revealing 4 of the 24 pairs of chromosomes in the great apes, but it indicates that they most likely derived from the same common ancestor. </div><div><br></div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/d5e5bf5af28e12b47431e641243a8ef9/g_and_c_chromosome.png" />
         <pubDate>2017-05-31 11:06:15 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174594478</guid>
      </item>
      <item>
         <title>Chromosomal Comparison between Humans and Chimpanzees</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174595063</link>
         <description><![CDATA[<div>Chimpanzees and humans also share many chromosomal similarities. In fact, these two species are more related than either are to gorillas. However, because both humans and gorillas are closely related to chimps, they must be related to each other as well.</div><div><br></div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/7d89ab2ddf7d7648b60df44065eb0932/Screen_Shot_2017_05_08_at_11_54_08_PM.png" />
         <pubDate>2017-05-31 11:11:42 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174595063</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174601304</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/8bd3743dfdc5d92ba41277928613d8d8/G_C_P_comparison.png" />
         <pubDate>2017-05-31 12:05:17 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174601304</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174602743</link>
         <description><![CDATA[<div>When studying chromosomes and DNA to prove evolution, it is critical to understand that silent mutations can occur during transcription and translation that do not disrupt the protein production in DNA. Scientists have made the conclusions that great apes share many identical DNA sequences, but they have all experienced silent mutations in non-coding sections of their DNA. Scientists have been able to study the regular rate of change for these mutations. This knowledge has lead to the estimation that chimps and humans split 3-6 million years ago. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 12:15:24 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174602743</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174605451</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/0c5546e8c139c37aec21400419fa0929/chromosome_connections__all_apes.png" />
         <pubDate>2017-05-31 12:31:44 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174605451</guid>
      </item>
      <item>
         <title>    Evolution in Action</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174605813</link>
         <description><![CDATA[]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 12:34:01 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174605813</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174606346</link>
         <description><![CDATA[<div><strong>S<br>P<br>E<br>C<br>I<br>A<br>T<br>I<br>O<br>N</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 12:36:28 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174606346</guid>
      </item>
      <item>
         <title>Gradualism</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174606761</link>
         <description><![CDATA[<div>Great apes seem to follow a gradual process of evolution. They have been around for millions of years, and they make small changes throughout their evolutionary process. All the organisms within the taxonomic group still share many similarities and are all closely connected.&nbsp; The oldest great ape dates back about 16 million years, and speciations have created four major species, orangutans, gorillas, chimpanzees, and humans.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 12:38:45 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174606761</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174607825</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/3900fcb51d47eb149d113a1c140930ae/phylogenic_tree_1.png" />
         <pubDate>2017-05-31 12:44:05 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174607825</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174609271</link>
         <description><![CDATA[<div>The tree shows that orangutans, gorilla, chimpanzees, and humans all derived from the same ancestor; this type of evolution is known as divergent evolution. Each split in the tree is fairly spaced out in time meaning speciation took a long time to get to where great apes are today due to gradualism. Orangutans split first, and then African apes spit resulting in speciation of the gorilla, fter, a common ancestor of humans and chimps split. Due to the many splits from the one common ancestor of great apes, there are several species in the family hominidae or great apes. &nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 12:51:05 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174609271</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174637083</link>
         <description><![CDATA[<div><strong>E<br>V<br>O<br>L<br>U<br>T<br>I<br>O<br>N</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 14:54:07 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174637083</guid>
      </item>
      <item>
         <title>Divergent Evolution </title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174638869</link>
         <description><![CDATA[<div>As mentioned above, great apes all evolved from one common ancestor. An example of a common ancestor that evolved and split into several species is Dryopithecus. Dryopithecus is an extinct ape that is classified in the same subfamily as humans, chimps, and gorillas. They were very dispersed throughout the globe; fossil evidence of this extinct species have been found in northeastern Spain (Catalonia), Hungary, China, eastern equatorial Africa, and northern India from the Miocene Epoch. They lived around 9-12 million years ago. Their teeth were the same as modern great apes, and they had thin enamel, which means they most likely consumed mainly fruits and leaves, like modern apes. Fossils of Dryopithecus shoulders indicate that they used their hand and feet to walk. All in all, dryopithecus shares similar behavioral and anatomical characteristics between humans, chimps, and gorillas. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 15:02:40 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174638869</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174679452</link>
         <description><![CDATA[<div><strong>I<br>S<br>O<br>L<br>A<br>T<br>I<br>O<br>N</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 18:05:41 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174679452</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174679708</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/ef23da2355446879e319e3a2703f99be/dryopithecus.png" />
         <pubDate>2017-05-31 18:07:03 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174679708</guid>
      </item>
      <item>
         <title>Minor Divergent Evolution</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174682603</link>
         <description><![CDATA[<div>There used to be one species of orangutan that split from the other great apes. However, about 40,000 years ago, orangutans experienced divergent evolution and divided into two separate species. As a result, there are now two orangutan species, Bornean and Sumatran. The cause for their divergence was when the Southeast Asian islands of Borneo and Sumatra were once one large island, which later separated. Their tectonic plates split and they begin to drift apart. Geographic isolation of the orangutan population lead to divergent evolution.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 18:21:41 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174682603</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174684475</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/acdf69764bdd1c0a43bb9f70d064c9e1/Two_Types_of_orangutans.jpg" />
         <pubDate>2017-05-31 18:30:55 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174684475</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174699703</link>
         <description><![CDATA[<div>Geographic isolation has contributed to the many species and subspecies within primates. Reproductive isolation has not had a dramatic affect on great apes, except restrive mating by the male hierarchy. &nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-05-31 20:14:07 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174699703</guid>
      </item>
      <item>
         <title>Geographic Isolation</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174721358</link>
         <description><![CDATA[<div>There are three groups of chimpanzees in Central Africa that are all very close to one another. However, they are isolated by the Congo river and therefore do not interbreed. These chimp groups are in close proximity, but have some genetic variations. The species include pan troglodytes vellerosus, pan troglodytes troglodytes, and pan troglodytes schweinfurthii.<br><br>Lowland and highland gorillas are subspecies geographically separated by mountains; some species live in the mountains, and others live on the lowlands of the mountain ranges. Correspondingly, gorillas split into different species because they were unable to reach each other due to geographic barriers. Now they have developed differences such as group size; mountain gorillas have groups above 20 individuals and lowland gorillas no larger than 17-20. Also, mountain gorillas are often times larger in size with longer hair, while lowland gorillas are more likely to be found in trees.   </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 00:18:30 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174721358</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174723088</link>
         <description><![CDATA[]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/1184e228ab1a1b80bcdbdc37a1aaeea2/geographic_isolation_congo.png" />
         <pubDate>2017-06-01 00:37:00 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174723088</guid>
      </item>
      <item>
         <title>Reproductive Isolation</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174723339</link>
         <description><![CDATA[<div>Due to the male hierarchy, many alpha male chimpanzees and gorillas create reproductive isolation. Many times, the alpha male will shield many females from mating with other males. This will prevent genet flow within a group. The gene flow may slow due to alpha male superiority because sometimes he will kill offspring that are not his own. The lower the male is in the hierarchy, the harder it is for them to find a female to mate with. Mating strategies have evolved so females can overcome the hierarchy and chose a mate(s) from a larger pool of chimps/gorillas; consortship mating, an adult pair leave the social group for many days or weeks to mate, and extra-group mating, where females leave their communities and mate with males from nearby communities, but then return home.<br><br>Another factor that will prohibit conception is during a time of food shortage. These hardships affect female's menstrual cycles as it puts them in the wrong stage for a pregnancy. They are most fertile with a large food supply because mating and ovulation require a lot of energy. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 00:40:15 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174723339</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174728172</link>
         <description><![CDATA[<div><strong>M<br>A<br>T<br>I<br>N<br>G<br><br>P<br>A<br>T<br>T<br>E<br>R<br>N<br>S</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 01:42:27 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174728172</guid>
      </item>
      <item>
         <title>Nonrandom Mating</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174729289</link>
         <description><![CDATA[<div>Great apes practice nonrandom mating as they pick partners based on physical characteristics. They do not typically mate for life because mating is a social aspect of life. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 01:54:10 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174729289</guid>
      </item>
      <item>
         <title>Chimpanzee</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174733992</link>
         <description><![CDATA[<div>Females typically mate with many males when they are most fertile. They do not mate for life, most chimps mate as a social activity. This is because females do not reproduce often, and they have a longer time between births than most animals, at least 3-5 years. Their estrus cycles last 36 and they may be fertilized for about 6.5 days during the cycle. Males can reproduce at 16 and females can between 13 and 15. They attract males when they have anogenital swelling. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 02:42:47 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174733992</guid>
      </item>
      <item>
         <title>Gorilla</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174734855</link>
         <description><![CDATA[<div>The female estrus cycle lasts 30-33 days. Females have their first baby at age 10 and must wait at least 4 years between each birth. Females mate with many males during her estrus cycle. Females are attracted to the silverbacks, and they may try to get their attention by pursing their lips, slowly approaching him, establishing prolonged eye contact, touch him, and slap the ground in hopes to attract his attention. Males will grunt at females they are attracted to.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 02:51:22 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174734855</guid>
      </item>
      <item>
         <title>Orangutan</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174735246</link>
         <description><![CDATA[<div>Female's menstrual cycle is 22-30 days and they must wait at least 8 years between each offspring. They give birth for the first time at 14-15 years. Males 8-15 are unflanged and do not attract females, so they only mate when they rape females. The flanged males make calls to the females and wait for them to approach them before mating; the big cheeks forms at age 15-20.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 02:56:11 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174735246</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174736504</link>
         <description><![CDATA[<div><strong>I<br>M<br>M<br>I<br>G<br>R<br>A<br>T<br>I<br>O<br>N<br><br>&amp;<br><br>E<br>M<br>I<br>G<br>R<br>A<br>T<br>I<br>O<br>N</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:09:50 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174736504</guid>
      </item>
      <item>
         <title>Chimpanzees</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174736671</link>
         <description><![CDATA[<div>They live in social groups, typically the males stay in their native group all their lives, but females may leave at age 11. This will lead to inbreeding between neighboring groups. Typically, the males in the groups are more genetically related to eachother than females are. Females maintain the gene flow of chimpanzee species; if they didn’t immigrate to new groups, there would not be as much gene flow between the social groups. The only time males interact with other groups is to attack them.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:11:33 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174736671</guid>
      </item>
      <item>
         <title>Gorilla</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174736867</link>
         <description><![CDATA[<div>They live in social groups and males typically leave their native group when they reach adolescence. Before forming a new group, the emigrating males live on their own for a period of time (between a few months to a few years). Then they find females and form their own group. The western lowland gorilla groups have on average 8.4 members consisting of one silverback, reproductive females, and their offspring. Because each male develops their own group, it maintains gene fluidity throughout the gorilla population. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:14:30 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174736867</guid>
      </item>
      <item>
         <title>Orangutan</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174736992</link>
         <description><![CDATA[<div>They live own their own for the majority of their adult life. Subadults travel in small groups, but once they reach adulthood, they travel alone. Females travel with their offspring. However, when orangutans cross paths in the wild, they mate and form small groups that stay together for a few days to a few months after copulation. Since orangutans travel on their own and mate with any other orangutan, the gene flow is very fluid.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:15:56 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174736992</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174737131</link>
         <description><![CDATA[<div>This evolutionary mechanism contributes to the many species of great apes that exist. Since they all have migrate often, regardless if it is one gender or both, they create gene flow that allows for evolution to occur. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:18:18 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174737131</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174737343</link>
         <description><![CDATA[<div><strong>M<br>I<br>C<br>R<br>O<br>E<br>V<br>O<br>L<br>U<br>T<br>I<br>O<br>N</strong></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:21:34 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174737343</guid>
      </item>
      <item>
         <title>Arm and Leg Lengths</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174737422</link>
         <description><![CDATA[<div>At birth, human limbs are not long; shorter than the limbs of apes. As they develop further, the arms grow a little in length and legs grow much more because legs formed later in the womb, and take longer to develop than arms. The arms and legs of apes also grow, but grow less than the limbs of humans. Humans legs have become longer than other apes because it makes bipedalism easier; the longer the legs, the less energy needed in order to run.</div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/ccd55c57b5444e5b744e497e996750b3/Screen_Shot_2017_05_14_at_11_56_19_AM.png" />
         <pubDate>2017-06-01 03:22:20 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174737422</guid>
      </item>
      <item>
         <title>Heart and Lungs</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174737595</link>
         <description><![CDATA[<div>All mammal embryos develop hearts that form against the diaphragm. For humans the heart remains in this position because it is logical for bipedalism (it gives the heart support). Other great apes develop a lobe of the lungs between the heart and diaphragm because quadrupeds do not need the diaphragm to support their heart. </div><div><br></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:24:57 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174737595</guid>
      </item>
      <item>
         <title>Jaw</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174737789</link>
         <description><![CDATA[<div>Young humans and apes have similar jaw shapes as they are curved with small canine teeth. However, as apes mature, their jaws become rectangular and their canine teeth become sharp. The roundedness of human jaws allow them to speak easily.&nbsp;</div><div>(Human: top/ orangutan: bottom)</div>]]></description>
         <enclosure url="https://padletuploads.blob.core.windows.net/prod/201397641/11583e50c9f7b17d1d92e908c6121e2c/Screen_Shot_2017_05_14_at_12_12_46_PM.png" />
         <pubDate>2017-06-01 03:27:54 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174737789</guid>
      </item>
      <item>
         <title></title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174737920</link>
         <description><![CDATA[<div>Humans and other great apes share many similarities in fetal development. However, other great apes specialize the features that their fetuses had and eventually abandon them. Accordingly, baby great apes look more like humans than mature great apes. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:30:29 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174737920</guid>
      </item>
      <item>
         <title>Darwin&#39;s Theories of Evolution </title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174738059</link>
         <description><![CDATA[]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:33:23 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174738059</guid>
      </item>
      <item>
         <title>Decent With Modification </title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174738095</link>
         <description><![CDATA[<div>Decent with modification is the driving force of evolution. In this theory, Darwin thought that all living and extinct organisms came from one common ancestor. It states that species are able to change over time.<br>This theory can apply to great apes because they all derived from one common ancestor and developed many individuals species due to speciation. Great apes went through divergent evolution, which means that their common ancestor branched off into many species including orangutans, gorillas, chimpanzees, and humans. These organisms are all very similar as they share many banding patterns visible in their DNA. They also share anatomical structures, stages of development as embryos, and their antibodies prove that they can detect the proteins of the other species. All of these evidences proves that orangutans, gorillas, chimpanzees, and humans are all very similar because they experienced decent with modification; they came from one common ancestor that changed overtime. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:34:07 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174738095</guid>
      </item>
      <item>
         <title>                                     Natural Selection</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174738257</link>
         <description><![CDATA[<div>Natural Selection allows decent with modification to occur. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:36:45 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174738257</guid>
      </item>
      <item>
         <title>Chimpanzee</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174739152</link>
         <description><![CDATA[<div>Directional Selection: Males have a hierarchy within their social groups. At the top is the alpha male and at the bottom are males that have no power in a social group. Therefore, the alpha males are more fit for their environment because they make all the decisions and have great power over the resources and mating of the group.&nbsp;</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:50:13 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174739152</guid>
      </item>
      <item>
         <title>Gorilla</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174739171</link>
         <description><![CDATA[<div>Stabilizing Selection: Most male gorillas develop silverbacks because this trait makes them superior to other males in a social group. Silverbacks make all the decisions within groups such as when to wake up, eat, travel, and sleep for the night. Silverbacks tend to be the aggressive because they are protective over their group. He will beat his chest and attacks against threateners.</div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:50:25 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174739171</guid>
      </item>
      <item>
         <title>Orangutan</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174739175</link>
         <description><![CDATA[<div>Stabilizing Selection: They have medium thickness coats of hair because it needs to be enough to regulate body temperature. The environment on Borneo is mild enough for medium thickness hair to be sufficient. If it is too thick, it will be too hot for their environments, but if it is too thin, they will not stay warm. </div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 03:50:30 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174739175</guid>
      </item>
      <item>
         <title>Sources</title>
         <author>ks466</author>
         <link>https://padlet.com/ks466/spog4d2hfn68/wish/174800519</link>
         <description><![CDATA[<div><a href="https://docs.google.com/document/d/1wFrOvjvjpTLCS34YTNXmLrvtSIowZnu-gu5bjRsADJc/edit">https://docs.google.com/document/d/1wFrOvjvjpTLCS34YTNXmLrvtSIowZnu-gu5bjRsADJc/edit</a></div>]]></description>
         <enclosure url="" />
         <pubDate>2017-06-01 12:41:51 UTC</pubDate>
         <guid>https://padlet.com/ks466/spog4d2hfn68/wish/174800519</guid>
      </item>
   </channel>
</rss>
