Sickle Cell Disease by CARISSA MATTHEWS https://padlet.com/ckm002/sl0zlsoanf1vr1ww By Carissa Matthews and Carson DiLorenzo en-us 2022-10-20 16:46:42 UTC 2022-11-13 13:18:59 UTC hello@padlet.com https://images.medicaldaily.com/sites/medicaldaily.com/files/2014/06/19/sickle-cell-disease.jpg Introduction ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349463792 Sickle cell disease is a point-mutation disorder in which the hemoglobin (Hb) beta subunit gene (HBB) on chromosome 11 (p15.5) is affected (Frangoul 2021). The version that we will be analyzing is the HB1 allele mutation.This mutation replaces the glutamic acid in position six of the the HBB gene with valine (Frangoul 2021). 

Normally, this gene functions by providing the necessary instructions for the production of beta-globulin, which comprises half of the subunits that make up Hb (Frangoul 2021). 

If someone were to have one HB1 and one HBB allele, their Hb would not be sickled and they would be phenotypically normal (Disorders 2019). However, if they have two HB1 alleles, they will show the effects of the disease (Disorders 2019).



]]> 2022-10-20 17:23:40 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349463792 Signs and Symptoms ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349466662 According to estimates, 312,000 babies are born every year with sickle cell anemia, the majority of which are from Sub-Saharan Africa (Carlice-dos-Reis 2017).

Sickled red blood cells can cause anemia, painful episodes, swelling of hands and feet, frequent infections, vision problems, and delayed puberty/growth (Mayo 2021).






]]> 2022-10-20 17:25:31 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349466662 References ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349467039 Carlice-dos-Reis T, Viana J, Moreira FC, Cardoso G de L, Guerreiro J, Santos S, Ribeiro-dos-Santos Â. 2017. Investigation of mutations in the HBB gene using the 1,000 genomes database. PLoS ONE. 12(4). doi:10.1371/journal.pone.0174637. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5381778/.

Disorders H, Affected G-H. Allele Profile Genetic Disorder -Hemoglobin Disorder. 2019. https://teach.genetics.utah.edu/content/genetics/files/alleles_hemoglobin.pdf.
‌
Frangoul H, Altshuler D, Cappellini MD, Chen Y-S, Domm J, Eustace BK, Foell J, de la Fuente J, Grupp S, Handgretinger R, et al. 2020. CRISPR-Cas9 Gene Editing for Sickle Cell Disease and β-Thalassemia. New England Journal of Medicine. 384(3). doi:10.1056/nejmoa2031054. https://www.nejm.org/doi/full/10.1056/NEJMoa2031054.
‌
HBB gene: MedlinePlus Genetics. medlineplusgov. https://medlineplus.gov/genetics/gene/hbb/#:~:text=Normal%20Function&text=The%20HBB%20gene%20provides%20instructions.
‌
Mayo Clinic. 2021 Jul 17. Sickle Cell Anemia - Symptoms and Causes. Mayo Clinic. https://www.mayoclinic.org/diseases-conditions/sickle-cell-anemia/symptoms-causes/syc-20355876.
‌
]]> 2022-10-20 17:25:43 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349467039 What happens to the mRNA on the HBB gene? ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349499958 This disease causes a change from glutamic acid to valine in amino acid six of the HBB gene (Frangoul 2021). This means that within the nucleotides of the HBB gene, one of the glutamic acid amino acids is replaced with valine.

We can see that bases eight of the seventh codon on the DNA strands are different. In the healthy allele, it is a T. In the affected allele, it is an A. When the RNA transcribes the template strand, the healthy allele codes for GAG (Glutamic acid) and the affected allele codes for GTG (valine) (Disorders 2019).


]]> 2022-10-20 17:46:26 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349499958 Considering this mutation, what happens to the protein after the HBB gene is translated? ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349559437 Translation occurs normally with affected beta-globulins produced. These affected beta-globulins cause a structural change in Hb, making them stick together in the blood due to the residual sickle shape (Disorders 2019). 

Although Hb can still transport oxygen in the blood, it does so less efficiently as it can become trapped in small blood vessels (Disorders 2019).]]> 2022-10-20 18:27:21 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349559437 How does this protein change cause the disease's symptoms? ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349575019 Anemia results when the sickled Hb cells die as they die more frequently than normal Hb cells (Mayo 2021). When this happens, a deficit of red blood cells occurs, which causes less oxygen to be transported around the body, resulting in fatigue (Mayo 2021).This can cause clots and slow growth in infants through adolescence (Mayo 2021).

These clots prevent blood from getting to your joints, chest, and belly through your blood arteries, which results in painful episodes and vision problem (Mayo 2021).

Swelling occurs due to poor circulation of the sickled red blood cells (Mayo 2021).

The spleen can also sustain damage by sickled red blood cells, making the body more suceptible to infections (Mayo 2021).]]> 2022-10-20 18:38:55 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349575019 Central dogma of molecular biology ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349607997 According to the central dogma, proteins are created through the transcription of DNA and the translation of RNA. In this project, we have demonstrated that HB1 sickle cell disease is caused by a point mutation in the HB1 allele on the HBB gene which then causes proteins to be made with a sickled shape.]]> 2022-10-20 19:05:28 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2349607997 Roadmap of codons 5-12 of the HBB gene ckm002 https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2355772571 This is the corresponding mRNA sequence of the upper template strand in Figure One. The template strand is ordered 3' to 5' left to right.

mRNA: 5’- ACUCCUGAGGAGAAGUCUGCCGUU -3’

Mutated mRNA: 5’-ACUCCUGUGGAGAAGUCUGCCGGUU -3’

Amino Acids (AAs) from the mRNA: N-term- Thr - Pro - Glu - Lys - Ser - Ala - Val - C-term

AAs from the mutated mRNA: N-term- Thr - Pro - Val - Lys - Ser - Ala - Val - C-term



]]> 2022-10-25 16:26:24 UTC https://padlet.com/ckm002/sl0zlsoanf1vr1ww/wish/2355772571