<?xml version="1.0"?>
<rss version="2.0">
   <channel>
      <title>8-2 A Social Studies by Reed Farrar</title>
      <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki</link>
      <description>Post your response to the discussion topic by clicking the plus button below.</description>
      <language>en-us</language>
      <pubDate>2025-09-18 12:59:03 UTC</pubDate>
      <lastBuildDate>2026-06-04 14:30:45 UTC</lastBuildDate>
      <webMaster>hello@padlet.com</webMaster>
      <image>
         <url>https://padlet.net/icons/png/1f4ac.png</url>
      </image>
      <item>
         <title>Final May / June Padlet Response</title>
         <author>rfarrar6</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939618336</link>
         <description><![CDATA[<p>Answer each of these in complete sentences with good details and evidence.&nbsp; Put a number 1, 2 and 3 to start your answers. Add a school appropriate photo or gif to your post. Perhaps one of a part time job you could do?</p><p><br/></p><p>1. The first story discussed how fewer teens want to work part time jobs.&nbsp; How about you?&nbsp; Do you plan to work this summer or during the school year?&nbsp; If yes what kind of work might be the job you do? At a company or for your own family?</p><p><br/></p><p>2. Our next story talked about diseases associated with travel.&nbsp; What were some of the tips the story told you to avoid catching these illnesses?</p><p><br/></p><p>3. Finally, there was a story about a Japanese game to secretely eat during class.&nbsp; In your opinion, if you could munch on things at any time, in any class, would that be a good thing or would that impact your work and learning?</p><p><br/></p>]]></description>
         <enclosure url="https://padlet-uploads-usc1.storage.googleapis.com/1425390569/1bb20da825e69b0ba00769ab4ba23e04/del_MIJ_L_MARCUS_COL_0201_02_dc7a1c.webp" />
         <pubDate>2026-06-03 12:31:34 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939618336</guid>
      </item>
      <item>
         <title>Derrick&#39;s World A to Z Response</title>
         <author>30johnsond3</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939762576</link>
         <description><![CDATA[<p>1. Personally, I don't plan to work this summer, but maybe during the school year. I probably will either work track meets and time them, or just get a job at a fast food place or Hannaford. But I don't think that places are going to hire a 14-year-old boy who isn't in high school yet over 16-17-year-old people.</p><p>2. Some tips that I was told to wash my hands and bring hand sanitizer after touching some places that came in contact with a lot of people previously.</p><ol start="3"><li><p>I don't believe that being able to snack anytime would benefit my learning, and it would negatively affect me. The amount of distractions that could be caused by snacking and the crunches would take away from my learning and probably even ruin my grades.</p></li></ol><p><br></p>]]></description>
         <enclosure url="https://genai-public.padletcdn.com/disco/prod/imagen/1780497345024/sample_0.png" />
         <pubDate>2026-06-03 14:24:48 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939762576</guid>
      </item>
      <item>
         <title>A to Z World Response</title>
         <author>30porterc</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763193</link>
         <description><![CDATA[<ol><li><p>No, I do not plan on working this summer. If I was to change my mind though I would work for my dad and his business.  </p></li><li><p>Some tips for not getting sick on trips would be to wash hands, buy hand sanitizer, wear long pants and shirts, and avoid touching my eyes. The long pants and shirts would be to keep ticks and other bugs off of my skin making it harder for them to bite me. </p></li><li><p>I think that it would be a good thing because it would teach students responsibility. Even though this could distract some people it could serve as another teaching tool. Also its hard to focus in class if you are hungry so a snack could help you focus on the lesson. </p></li></ol>]]></description>
         <enclosure url="https://upload.wikimedia.org/wikipedia/commons/7/7e/Boy_eating_sandwich_%28520732%29.jpg" />
         <pubDate>2026-06-03 14:25:06 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763193</guid>
      </item>
      <item>
         <title>A to Z response </title>
         <author>30ericksona</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763288</link>
         <description><![CDATA[<ol><li><p>I work at my dad's store every Monday, Wednesday and Saturday. (Hardware store and ice cream shop)</p></li><li><p>The tips were to bring products like masks, sunscreen, aloe, bug spray and a safety kit for emergencies.</p></li><li><p> I think it would be a great thing considering sometimes kids cant focus when their hungry so they stop paying attention and start counting down the seconds until lunch</p></li></ol>]]></description>
         <enclosure url="https://media0.giphy.com/media/v1.Y2lkPWNhYmM5OTE4a2pheXR6dXl1MzdmZHptZTdncG5wOXE0MjkxaGdkdW43OW8yeGVwOCZlcD12MV9naWZzX3NlYXJjaCZjdD1n/l44QjgeQ5ium91n9K/giphy.gif" />
         <pubDate>2026-06-03 14:25:12 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763288</guid>
      </item>
      <item>
         <title>A to Z Response</title>
         <author>30bourques</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763483</link>
         <description><![CDATA[<ol><li><p>A couple of weeks ago, my friend and I took a babysitting course and are now Red Cross-certified. This means I'm more likely to get jobs because I have training in babysitting children from infants to preteens. I will also be a counselor at multiple summer camps this year and am looking forward to volunteering. It's a running joke in my family that I will partake in headlight restoration because my dad believes it is an underrated job that will make me lots of money. There is always the option of working for my dads buisness as well, he does inspections, gutter installations, and recently has invested in these permanent Christmas lights for your gutters and has already installed them on our house.</p></li><li><p>Much like the video said, washing your hands is the first step to keeping clean and preventing the spread of germs. Other ways, like covering your mouth when you cough or sneeze, or keeping your hands to yourself and not touching things that others might have touched, like escalator railings (which are really gross).</p></li><li><p>I feel that if we were to bring snacks, it might enhance our learning by limiting hunger before lunch, but it can also become a distraction. Many students are often prone to asking others for a "piece" or a "bite of something which can become a diversion from actual work.</p></li></ol>]]></description>
         <enclosure url="https://media4.giphy.com/media/v1.Y2lkPWNhYmM5OTE4dHY3cDN3cnByZXQzdzgwOGZ2NnUya2lsOWx2eG94NGh4bmtjOXRociZlcD12MV9naWZzX3NlYXJjaCZjdD1n/CprnDw0e7u1IHOioYp/giphy.gif" />
         <pubDate>2026-06-03 14:25:25 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763483</guid>
      </item>
      <item>
         <title>A-Z response</title>
         <author>30pelletierj</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763532</link>
         <description><![CDATA[<ol><li><p>I plan to work and I go up to my grandpas farm and I usually work 2-3 weeks getting minimum wage. I also sort of have a car cleaning business, it is not public but friends and people close to me bring their cars over for interior and deep cleaning.</p></li><li><p> To wear appropriate clothes and have an emergency health bag if something were to go wrong.</p></li><li><p> I think we should keep it to one class only that you can eat in because wrappers and eating could effect peoples work and what they are able to get done in class.</p></li></ol>]]></description>
         <enclosure url="https://media2.giphy.com/media/v1.Y2lkPWNhYmM5OTE4cmgzZXNoMmJwazZta3JncHVnYXd3YjJoc256OXdqaDJiNHpvdm93dyZlcD12MV9naWZzX3NlYXJjaCZjdD1n/r3wBjiID1NR9PMIQ1i/giphy.gif" />
         <pubDate>2026-06-03 14:25:28 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763532</guid>
      </item>
      <item>
         <title>Barrett&#39;s response</title>
         <author>30gallantb</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763749</link>
         <description><![CDATA[<ol><li><p>Yes, I would like to work at some point in the year of 2026, I know that I will haul lobsters on Vinalhaven again with my cousins but I would like to find a sufficient year round job. I also get paid to ump little league games and play in my summer basketball league.</p></li><li><p>Hand washing, wear long sleeves while traveling through terrain with ticks and mosquitoes.</p></li><li><p>I believe that this would be a good thing for the school to normalize. I think this because a lot of people do not eat breakfast which means they have to wait until noon to eat, and it is very hard to work and think up to your full potential when you have an empty stomach.</p></li></ol>]]></description>
         <enclosure url="https://media2.giphy.com/media/v1.Y2lkPWNhYmM5OTE4cDlrbXl0cTR5MGY4ZXo0aTZiZmJ1ejc1aWlrbWZyYjF3aHNyMmdwdyZlcD12MV9naWZzX3NlYXJjaCZjdD1n/2CanGQ7dzlmjBqhZRs/giphy.gif" />
         <pubDate>2026-06-03 14:25:42 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939763749</guid>
      </item>
      <item>
         <title> final padlet of 8th grade so sad logan w </title>
         <author>30wardl</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939764075</link>
         <description><![CDATA[<ol><li><p>Yes, I plan to work a lot this summer. I already work quite a bit during  the school year, and I will work on my family's farm and for a construction company</p></li><li><p>To wear appropriate clothes and have a plan if something were to go wrong, also have an emergency health bag</p></li><li><p>I don't really think it would.  I think it should be up to the teacher unless someone above them tells them otherwise</p></li></ol>]]></description>
         <enclosure url="https://media0.giphy.com/media/v1.Y2lkPWNhYmM5OTE4dDFjY2I0cW0xODJ1MWhucG1oODdhNHVpZml2cmd5aXRsZG5penJ2dCZlcD12MV9naWZzX3NlYXJjaCZjdD1n/YdC7XMdkATE8WyOFWI/giphy.gif" />
         <pubDate>2026-06-03 14:26:02 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939764075</guid>
      </item>
      <item>
         <title>Final Padlet Response (Ryder)</title>
         <author>catcatcatcatcatcatcatcatcatcatcatcatcatcatcat</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939764691</link>
         <description><![CDATA[<p>1 This summer, I do not plan to work a part-time job as I am going on a vacation away from the United States.</p><p><br/></p><p>2 Some tips to avoid contracting diseases from travel include hand washing, using sanitizers and rubbing alcohol, and bringing plenty of bug spray to prevent vector-borne diseases such as malaria and Lyme disease.</p><p><br/></p><p>3 The consumption of food in class can be both a pro and a con to learning. Usually, it depends on what class. In free-time and less structures courses, eating food can satisfy hunger and lead to better productivity. However, in other classes, eating can become a distraction and can end up becoming a hindrance to learning. And, eating without proper sanitization can lead to diseases.</p><p><br/></p><p>Ryder </p><p><br/></p><p><br/></p>]]></description>
         <enclosure url="https://padlet-uploads-usc1.storage.googleapis.com/2749770826/8006b8304a53f25c1ea9292652b43a7f/Screen_recording_2026_06_03_10_26_13_AM.gif" />
         <pubDate>2026-06-03 14:26:33 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939764691</guid>
      </item>
      <item>
         <title>Response padlet to A to Z world A to Z response for responding purposes response respond. Chair.</title>
         <author>30bowdenl</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939765607</link>
         <description><![CDATA[<ol><li><p>I do plan to do some work over the summer, mostly just moving items and other various job activities. I would be doing this work for my own family.</p></li><li><p>To avoid disease while traveling, they suggested washing your hands, keeping your hands away from your face. They also suggested taking certain items depending on where you are going, such as long sleeved shirts, insect repellent, aloe, and other items.</p></li><li><p>I think that if I could eat things at any time, it would help me because I would not be hungry before going to lunch, and thus would be able to focus better. It would not really negatively impact my learning, but also not positively, since I almost never bring any food items to school anyways.</p></li></ol>]]></description>
         <enclosure url="https://media4.giphy.com/media/v1.Y2lkPWNhYmM5OTE4a2wwZHZ4b3liNnM3ZXFscXl5MW5reWhmempvN3VnZDFyZjZiNmF6YSZlcD12MV9naWZzX3NlYXJjaCZjdD1n/d2ItDZZumUI6Y/giphy.gif" />
         <pubDate>2026-06-03 14:26:58 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939765607</guid>
      </item>
      <item>
         <title>World A to Z Response</title>
         <author>30pennellh</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939765610</link>
         <description><![CDATA[<ol><li><p>This summer, I would like to get a job, but I do not know where I would want to be employed. I might try detailing cars, as I make sure every last inch of something is clean.</p></li><li><p>When going on a trip, always remember to wash your hands, use hand sanitizer, and pack medical items depending on where you are going. If you have not washed your hands, avoid touching your face, and avoid unsanitary locations.</p></li><li><p>I believe that it would be very beneficial, as many people, including myself, work much more efficiently if they are eating something. Allowing students to work on a full stomach would make them much more able to learn.</p></li></ol>]]></description>
         <enclosure url="https://padlet-uploads-usc1.storage.googleapis.com/4420075973/7228a205b70c2eaccfb8ef8c3cfec620/download__11_.jpeg" />
         <pubDate>2026-06-03 14:26:58 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939765610</guid>
      </item>
      <item>
         <title>Greyson&#39;s Padlet Response</title>
         <author>30rhinehartg</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766066</link>
         <description><![CDATA[<p>1. I am excited to work a job and earn my own money and buy my own things. The job I have already lined up, I need to be fifteen to work, so I am going to wait until my birthday in October to work part-time. The job I am going to do is a busser at a restaurant, at a company I'll be working at, Geaghan's, because my parents work there and know the owners really well.</p><p>2. Some of the tips they gave us were to thoroughly wash your hands, bring hand sanitizer, try not to touch your face a whole lot, and wear clothes that cover your skin when you go to a place that could have a lot of disease-carrying bugs. </p><p>3. I think eating in class wouldn't be a distraction, but I think some people would bring like a whole feast in class, and that would probably be pretty distracting.</p>]]></description>
         <enclosure url="https://media1.giphy.com/media/v1.Y2lkPWNhYmM5OTE4b3V2dHcwbWo5YXF5M3h6MHl6c21zZmM1dTZod3R1a3VobjA2OWl3MSZlcD12MV9naWZzX3NlYXJjaCZjdD1n/di3fwtPhjXOpL9KcUJ/giphy.gif" />
         <pubDate>2026-06-03 14:27:20 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766066</guid>
      </item>
      <item>
         <title>My response.</title>
         <author>30amone</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766598</link>
         <description><![CDATA[<ol><li><p>No, I don't plan on working this summer. I don't have a job; I still do work around the house and will get paid for it. I don't know any places that would hire a 13-year-old to do work.</p></li><li><p>Bring sanitizer. Have a bag with supplies, and wear appropriate clothes depending on what area you are in.</p></li><li><p>I think it could be a good thing for us if we're hungry, but if we're trying to be taught a lesson, then it might be a distraction, since one person might have a snack and then everyone wants a snack, and it will cause a distraction. And then some students might not even get any work done.</p></li></ol>]]></description>
         <enclosure url="https://media.tenor.com/I13_hvT0954AAAAe/onion-ring-onion.png" />
         <pubDate>2026-06-03 14:27:46 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766598</guid>
      </item>
      <item>
         <title>Braddock&#39;s Response</title>
         <author>30stansaukb</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766727</link>
         <description><![CDATA[<p>1. Yes, I do. There is a wide variety of stuff that I do like, building fences, moving, and cleaning stuff out of barns.</p><p>2. One tip is to wash your hands very often, to bring medicine that you use daily, and to drink lots of water.</p><p> 3. I think that a good food to eat during class is some sort of gummy food because of how quiet it is. I think that food in class would impact our learning because it would cause people to pay attention.</p>]]></description>
         <enclosure url="https://media.tenor.com/QMMfU2fE4VwAAAAe/girl-sneaky.png" />
         <pubDate>2026-06-03 14:27:51 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766727</guid>
      </item>
      <item>
         <title>World A-z response</title>
         <author>30lynchk</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766876</link>
         <description><![CDATA[<p>1. I think even if you are busy, you should find some time to work. I am going to find some time to work over the summer because it is a good way to pick up a few extra dollars, which I could put toward a car. I think I would work for my grandfather so that way while i am working for my car.</p><p>2. I would make sure to wash my hands and keep them away from my mouth and nose.</p><ol start="3"><li><p>I think that if you bring an appropriate snack that doesn't distract the class, then you should be fine to bring in food.</p></li></ol><p><br></p>]]></description>
         <enclosure url="https://media1.tenor.com/m/O4tpJ68CmUoAAAAd/50-son-son.gif" />
         <pubDate>2026-06-03 14:27:59 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939766876</guid>
      </item>
      <item>
         <title>welly&#39;s response</title>
         <author>30cowanw</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939767421</link>
         <description><![CDATA[<ol><li><p>I plan to do yard work and help in the ice cream kitchen with my parents, to be sold at the shop.</p></li><li><p>some wayt to prevent desease while traveling are to always wash you hands ana pack hand sanitizer after touching surfaces that have seen many hands. you should also ceep you hand away from your face and check for ticks in tall grass.</p></li><li><p>I do not think that having food in class impacts your work and can actually help your focus if done properly without having to sneek it.</p><p><br/></p></li></ol>]]></description>
         <enclosure url="https://media.tenor.com/JbLyPKtCIa4AAAAM/big-buger-eat-buger.gif" />
         <pubDate>2026-06-03 14:28:29 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939767421</guid>
      </item>
      <item>
         <title>Ethan&#39;s response</title>
         <author>30whitee1</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939767468</link>
         <description><![CDATA[<ol><li><p>I plan on getting a job this summer at a company most likely fast food worker or groceries store worker.</p></li><li><p>bug spray, check for ticks or mosquitoes, and pack a bag with medical items in it like aloe.</p></li><li><p>It would depend if other people eat loudly or obnoxiously but it probably wouldn't help me learn or work because I often don't buy snacks but if I did it might help.</p></li></ol>]]></description>
         <enclosure url="https://elvis.padletcdn.com/1/fetch/e_in/pixabay.com/get/g1e1ec5bbaab773c434e7884a6d3a0d2566809c7fb471fc3786a95fc11083f97d39e2135b1d1ce28c2e26d2e3cdfe6ce8.jpg" />
         <pubDate>2026-06-03 14:28:34 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939767468</guid>
      </item>
      <item>
         <title>World A to S Response</title>
         <author>30wentworthi</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939767742</link>
         <description><![CDATA[<ol><li><p>This summer, my family and I are planning on doing a lot of travelling, so having a job would be a bit inconvenient. Even though I want to have a job, I'm not sure I would be able to. If I were to do a summer job, I would want to work as a camp counselor so I could also have a good experience with the job, and create a good experience. Sometimes, I work at my grandparents' small cafe, but a lot of the time I either have dance or another prior commitment. </p></li><li><p>Many times after travelling to a foreign place, or even a place closer to home, you end up coming back with diseases. In the video, it advises you to not only stay cautious and healthy while you're there, but pack in preparation for a medical event. The video advises you to pack a medical bag to bring with you holding essentials that could help prevent sickness, such as a mask and antibiotics. Keeping these things with you as you travel can help to stop the spread of any illnesses that you might be affected by while away from home. </p></li><li><p>Personally, I think being able to eat in school would be a welcome change. If people weren't distracting others while they were eating food or getting it on any of their work, it could help many people to stay energized and focus in class. Some people might take advantage of this and distract other people with their food. Also, some people might not have extra food that they can bring in, so I think having a dedicated snack and snack time would be much more efficient and helpful than just free lance eating. </p></li></ol>]]></description>
         <enclosure url="https://upload.wikimedia.org/wikipedia/commons/c/c8/HK_food_culture_dancing_chicken_funny_or_bad_taste_2016_oil_deep_fried.jpg?utm_source=commons.wikimedia.org&amp;utm_campaign=index&amp;utm_content=original" />
         <pubDate>2026-06-03 14:28:47 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939767742</guid>
      </item>
      <item>
         <title>Response to A to Z</title>
         <author>30petersc</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939768715</link>
         <description><![CDATA[<ol><li><p>I don't plan on having a job this year because I am doing field hockey preseason and I have to help out around the house. I am making twenty dollars a week with the chores that I do. When we get into high school I plan on working at a smaller business or fast food place. </p></li><li><p>Some helpful tips that you can use to avoid catching diseases while on a trip is to consistently wash your hands, avoid touching your face and eyes, and you can wear pants and long sleeve shirts to avoid Malaria and Lyme Disease. Another thing you can do is make sure your food is untouched and that you have your own drink. This can help prevent the spread of germs from person to person. You could also make sure you keep up with hygiene because it will help keep you healthy.</p></li><li><p>I think it is essential for students to have access to snacks during school because it can help students stay focused. However there is a fine line between when snacking is a resource and a distraction and I think that students should be able to eat during class as long as it isn't a distraction to them or others.</p></li></ol>]]></description>
         <enclosure url="https://media.tenor.com/jSIzgNLgbVYAAAAe/wash-hands-wash-your-hands.png" />
         <pubDate>2026-06-03 14:29:45 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939768715</guid>
      </item>
      <item>
         <title>World A to Z Response</title>
         <author>30hallettg</author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939769188</link>
         <description><![CDATA[<ol><li><p>I would like to work this summer so that I can start paying for more things myself. I already do chores and work around the house to help pay for some things, but I would like to work at a company/store so that I can experience having a real job. I think that the lessons that come with having a job are very important for teenagers to learn, and it also teaches responsibility with the money that you earn. Having a job, even if it's only in the summer because many teens are busy during the school year, can be very beneficial and I think I would like to have one. </p></li><li><p>To avoid catching diseases on trips the video advised you to take care with your hygiene. This includes washing your hands with soap and water, using hand sanitizer directly after touching something that many people touch and therefore could be contaminated, and wearing a mask. These are tips to avoid illnesses/diseases that spread easily from germs, but other diseases you could catch on trips include Lyme disease and malaria. Since these come from insects, (ticks and mosquitoes) the ways to prevent them include wearing long clothing that covers your skin, wearing bug spray, and checking for ticks and mosquitoes directly after being outside.</p></li><li><p>I think that being able to eat in class could potentially be a good thing. Some people work better while eating, or on a full stomach, but lunch is often not long enough or not filling enough for people. Eating in class could help people focus and increase their ability to complete their work. However, for people who do not work this way, it could be more difficult for them to focus. Eating in class is a controversial topic, and I think it should be up to each school or even classroom teacher, to decide. </p></li></ol>]]></description>
         <enclosure url="https://upload.wikimedia.org/wikipedia/commons/c/ca/Idafiun_food.jpg" />
         <pubDate>2026-06-03 14:30:07 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939769188</guid>
      </item>
      <item>
         <title>The world A-Z Answer</title>
         <author></author>
         <link>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939777168</link>
         <description><![CDATA[<ol><li><p>I have thought about planning to work this summer for some money, I was considering options like help people yard work, or help people do house work.</p></li><li><p>Some tips I was told was to wash my hands after doing something or putting on hand sanitizer, use bug spray outside,avoid touching my eyes when my hands are dirty.</p></li><li><p>If I could munch on something in class at school, I think it would make me work better and learn better because I will have more energy and research has shown, when a students stomach is empty or they haven't eaten it affects there learning because they are focused on thinking about when there gonna eat or something and students can think better and they less tired during school and it is better to have a full stomach during school because it will make students focus more on your work, and they can  think better and they  will also have more energy at school so they listen more and learn better.</p></li></ol>]]></description>
         <enclosure url="" />
         <pubDate>2026-06-03 14:37:01 UTC</pubDate>
         <guid>https://padlet.com/regionalschoolunit22/ala3sskjxnsj9aki/wish/3939777168</guid>
      </item>
   </channel>
</rss>
